A Chromosome-Level Genome Assembly of the Non-Hematophagous Leech Whitmania pigra (Whitman 1884): Identification and Expression Analysis of Antithrombotic Genes.

Despite being a non-hematophagous leech, Whitmania pigra is widely used in traditional Chinese medicine for the treatment of antithrombotic diseases. In this study, we provide a high quality genome of W. pigra and based on which, we performed a systematic identification of the potential antithrombotic genes and their corresponding proteins. We identified twenty antithrombotic gene families including thirteen coagulation inhibitors, three platelet aggregation inhibitors, three fibrinolysis enhancers, and one tissue penetration enhancer. Unexpectedly, a total of 79 antithrombotic genes were identified, more than a typical blood-feeding Hirudinaria manillensis, which had only 72 antithrombotic genes. In addition, combining with the RNA-seq data of W. pigra and H. manillensis, we calculated the expression levels of antithrombotic genes of the two species. Five and four gene families had significantly higher and lower expression levels in W. pigra than in H. manillensis, respectively. These results showed that the number and expression level of antithrombotic genes of a non-hematophagous leech are not always less than those of a hematophagous leech. Our study provides the most comprehensive collection of antithrombotic biomacromolecules from a non-hematophagous leech to date and will significantly enhance the investigation and utilization of leech derivatives in thrombosis therapy research and pharmaceutical applications.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Transcriptomic profiling and the first spatial expression analysis of candidate genes in the salivary gland of the East Asian medicinal leech, Hirudo nipponia.

Hirudo nipponia, a blood-sucking leech native to East Asia, possesses a rich repertoire of active ingredients in its saliva, showcasing significant medical potential due to its anticoagulant, anti-inflammatory, and antibacterial effects against human diseases. Despite previous studies on the transcriptomic and proteomic characteristics of leech saliva, which have identified medicinal compounds, our knowledge of tissue-specific transcriptomes and their spatial expression patterns remains incomplete. In this study, we conducted an extensive transcriptomic profiling of the salivary gland tissue in H. nipponia based on de novo assemblies of tissue-specific transcriptomes from the salivary gland, teeth, and general head region. Through gene ontology (GO) analysis and hierarchical clustering, we discovered a novel set of anti-coagulant factors-i.e., Hni-Antistasin, Hni-Ghilanten, Hni-Bdellin, Hni-Hirudin-as well as a previously unrecognized immune-related gene, Hni-GLIPR1 and uncharacterized salivary gland specific transcripts. By employing in situ hybridization, we provided the first visualization of gene expression sites within the salivary gland of H. nipponia. Our findings expand on our understanding of transcripts specifically expressed in the salivary gland of blood-sucking leeches, offering valuable resources for the exploration of previously unidentified substances with medicinal applications.

First description study on molecular characterization of Hemiclepsis khankiana (Hirudinea: Glossiphoniidae) in China.

BACKGROUND: Leeches are an integral component of aquatic biocenosis and can be found in a wide range of ecosystems such as freshwater, saltwater, flowing, and still-water ecosystems. It especially plays an important role in the freshwater benthic community and is an important part of the food web. In this study, a leech species was found in the mantle cavity of wild freshwater mussels in Zigong City, Sichuan Province, China, and its identity was determined through morphological analysis and molecular biological analysis. RESULTS: The leech is Hemiclepsis khankiana, a new species of Hemiclepsis that has been discovered in Russia in recent years. Through morphological analysis, the current survey observed that the morphological characteristics of Hemiclepsis khankiana eyespots were significantly different from the first reported description. The first pair of eyespots on the leech were separated and clear, while it had been reduced to unclear shadows in the previous report. The phylogenetic tree based on the COI gene showed that the COI gene sequence obtained in this study was in the same evolutionary branch as Hemiclepsis khankiana (MN295420, MN295421). Genetically, it was most closely related to Hemiclepsis kasmiana (mean COI p-distance = 3.98%). CONCLUSIONS: The current study reported on the new distribution range of Hemiclepsis khankiana, which was initially discovered in China. This study indicates that the distribution range of the leech species has expanded, laying a foundation for further studies in China.

Revisiting the Asian Buffalo Leech (Hirudinaria manillensis) Genome: Focus on Antithrombotic Genes and Their Corresponding Proteins.

Leeches are well-known annelids due to their obligate blood-feeding habits. Some leech species secrete various biologically active substances which have important medical and pharmaceutical value in antithrombotic treatments. In this study, we provided a high-quality genome of the Asian buffalo leech (Hirudinaria manillensis), based on which we performed a systematic identification of potential antithrombotic genes and their corresponding proteins. Combining automatic and manual prediction, we identified 21 antithrombotic gene families including fourteen coagulation inhibitors, three platelet aggregation inhibitors, three fibrinolysis enhancers, and one tissue penetration enhancer. A total of 72 antithrombotic genes, including two pseudogenes, were identified, including most of their corresponding proteins forming three or more disulfide bonds. Three protein families (LDTI, antistasin, and granulin) had internal tandem repeats containing 6, 10, and 12 conserved cysteines, respectively. We also measured the anticoagulant activities of the five identified hirudins (hirudin_Hman1 ~ hirudin_Hman5). The results showed that three (hirudin_Hman1, hirudin_Hman2, and hirudin_Hman5), but not the remaining two, exhibited anticoagulant activities. Our study provides the most comprehensive collection of antithrombotic biomacromolecules from a leech to date. These results will greatly facilitate the research and application of leech derivatives for medical and pharmaceutical purposes in the treatment of thrombotic diseases.

Evolution of an Alternative Genetic Code in the Providencia Symbiont of the Hematophagous Leech Haementeria acuecueyetzin.

Strict blood-feeding animals are confronted with a strong B-vitamin deficiency. Blood-feeding leeches from the Glossiphoniidae family, similarly to hematophagous insects, have evolved specialized organs called bacteriomes to harbor symbiotic bacteria. Leeches of the Haementeria genus have two pairs of globular bacteriomes attached to the esophagus which house intracellular "Candidatus Providencia siddallii" bacteria. Previous work analyzing a draft genome of the Providencia symbiont of the Mexican leech Haementeria officinalis showed that, in this species, the bacteria hold a reduced genome capable of synthesizing B vitamins. In this work, we aimed to expand our knowledge on the diversity and evolution of Providencia symbionts of Haementeria. For this purpose, we sequenced the symbiont genomes of three selected leech species. We found that all genomes are highly syntenic and have kept a stable genetic repertoire, mirroring ancient insect endosymbionts. Additionally, we found B-vitamin pathways to be conserved among these symbionts, pointing to a conserved symbiotic role. Lastly and most notably, we found that the symbiont of H. acuecueyetzin has evolved an alternative genetic code, affecting a portion of its proteome and showing evidence of a lineage-specific and likely intermediate stage of genetic code reassignment.

Chromosome-level Dinobdella ferox genome provided a molecular model for its specific parasitism.

BACKGROUND: Dinobdella ferox is the most frequently reported leech species parasitizing the mammalian nasal cavity. However, the molecular mechanism of this special parasitic behavior has remained largely unknown. METHODS: PacBio long-read sequencing, next-generation sequencing (NGS), and Hi-C sequencing were employed in this study to generate a novel genome of D. ferox, which was annotated with strong certainty using bioinformatics methods. The phylogenetic and genomic alterations of D. ferox were then studied extensively alongside the genomes of other closely related species. The obligatory parasitism mechanism of D. ferox was investigated using RNA-seq and proteomics data. RESULTS: PacBio long-read sequencing and NGS yielded an assembly of 228 Mb and contig N50 of 2.16 Mb. Along Hi-C sequencing, 96% of the sequences were anchored to nine linkage groups and a high-quality chromosome-level genome was generated. The completed genome included 19,242 protein-coding genes. For elucidating the molecular mechanism of nasal parasitism, transcriptome data were acquired from the digestive tract and front/rear ends of D. ferox. Examining secretory proteins in D. ferox saliva helped to identify intimate connections between these proteins and membrane proteins in nasal epithelial cells. These interacting proteins played important roles in extracellular matrix (ECM)-receptor interaction, tight junction, focal adhesion, and adherens junction. The interaction between D. ferox and mammalian nasal epithelial cells included three major steps of pattern recognition, mucin connection and breakdown, and repair of ECM. The remodeling of ECM between epithelial cells of the nasal mucosa and epithelial cells of D. ferox may produce a stable adhesion environment for parasitism. CONCLUSIONS: Our study represents the first-ever attempt to propose a molecular model for specific parasitism. This molecular model may serve as a practical reference for parasitism models of other species and a theoretical foundation for a molecular process of parasitism.

The pattern of stability of African swine fever virus in leeches.

African swine fever virus (ASFV) can accumulate and survive in leeches for a long time. The reasons for the survival of ASFV in leeches are not entirely clear. Here, we elucidate the virus survival pathway in infected leeches. One of the questions reported previously is addressed in this article. How the virus concentration in the body of the leech is equal to or higher than in the water infected with ASFV? Examination of blood swallowed by leeches reveals that the blood cells retain their morphological characteristics for several weeks. It can explain the long-term persistence of the high levels of ASFV in the leeches that ingested ASFV-infected pig blood. qRT-PCR assay showed the transcription of ASFV genes in infected leeches. However, the infectious particles of the virus measured by HADU haven't increased. Quantitative studies of the ASFV revealed a high content of both viral genes and infectious particles in the skin of leeches compared with other body parts. Electron microscopy analysis revealed the ability of the ASFV to effectively bind to the skin surface of the leeches, which explained the high concentrations of ASFV in the leeches' skin. A significant difference in the transcriptional activity between early and late viral genes indicates that the virus entered the initial stage of replication, but for some reason failed to complete it, which is typical of abortive infections.

Placobdella nabeulensis sp. nov. (Hirudinea: Glossiphoniidae), a new glossiphoniiform leech from Palearctic North Africa.

BACKGROUND: Herein, we describe a new species of turtle blood-feeding leech, Placobdella nabeulensis sp. nov. from Palearctic North Africa (Tunisia and Algeria). The new species is described based on detailed morphological analyses using light and scanning electron microscopes. RESULTS: Apart from the detailed morphology of the atrium, morphological features alone do not sufficiently separate the species from congeners due to the absence of distinct diagnostic characters. Therefore, we turned to molecular data to better distinguish this new species from other members of the genus and establish a basis for its genetic separation. Four DNA fragments were successfully amplified, including mitochondrial COI and 12S rDNA, as well as nuclear 28S rDNA and histone H3. We then provided the molecular descriptor of the taxon, based on redundant diagnostic nucleotide combinations in DNA sequence alignment within the Folmer region. Results of the phylogenetic analysis and species delimitation methods (ABGD, ASAP, and bPTP) based on the COI locus support the species rank of the Tunisian-Algerian Placobdella. CONCLUSIONS: The new species is most closely related to the European species Placobdella costata (Fr. Müller, 1846) and the present study indicates that Placobdella nabeulensis sp. nov. has likely been confused with the European counterpart in several previous studies. This article is registered at www.zoobank.org under urn:lsid:zoobank.org:pub:4A4B9C1D-2556-430F-8E4B-0CE99F2012F5.

Characterization of the natural peptidome of four leeches by integrated proteogenomics and pseudotargeted peptidomics.

Animal-derived drugs are an indispensable part of folk medicine worldwide. However, their chemical constituents are poorly approached, which leads to the low level of the quality standard system of animal-derived drugs and further causes a chaotic market. Natural peptides are ubiquitous throughout the organism, especially in animal-derived drugs. Thus, in this study, we used multi-source leeches, including Hirudo nipponica (HN), Whitmania pigra (WP), Whitmania acranulata (WA), and Poecilobdella manillensis (PM), as a model. A strategy integrating proteogenomics and novel pseudotargeted peptidomics was developed to characterize the natural peptide phenotype and screen for signature peptides of four leech species. First, natural peptides were sequenced against an in-house annotated protein database of closely related species constructed from RNA-seq data from the Sequence Read Archive (SRA) website, which is an open-sourced public archive resource. Second, a novel pseudotargeted peptidomics integrating peptide ion pair extraction and retention time transfer was established to achieve high coverage and quantitative accuracy of the natural peptides and to screen for signature peptides for species authentication. In all, 2323 natural peptides were identified from four leech species whose databases were poorly annotated. The strategy was shown to significantly improve peptide identification. In addition, 36 of 167 differential peptides screened by pseudotargeted proteomics were identified, and about one-third of them came from the leucine-rich repeat domain (LRR) proteins, which are widely distributed in organisms. Furthermore, six signature peptides were screened with good specificity and stability, and four of them were validated by synthetic standards. Finally, a dynamic multiple reaction monitoring (dMRM) method based on these signature peptides was established and revealed that one-half of the commercial samples and all of the Tongxinluo capsules were derived from WP. All in all, the strategy developed in this study was effective for natural peptide characterization and signature peptide screening, which could also be applied to other animal-derived drugs, especially for modelless species that are less studied in protein database annotation.

PTEROBDELLA OCCIDENTALIS N. SP. (HIRUDINIDA: PISCICOLIDAE) FOR P. ABDITOVESICULATA (MOORE, 1952) FROM THE LONGJAW MUDSUCKER, GILLICHTHYS MIRABILIS, AND STAGHORN SCULPIN, LEPTOCOTTUS ARMATUS, AND OTHER FISHES IN THE EASTERN PACIFIC.

Pterobdella occidentalis n. sp. (Hirudinida: Piscicolidae) is described from the longjaw mudsucker, Gillichthys mirabilis Cooper, 1864, and the staghorn sculpin, Leptocottus armatus Girard, 1854, in the eastern Pacific, and the diagnosis of Pterobdella abditovesiculata (Moore, 1952) from the 'o'opu 'akupa, Eleotris sandwicensis Vaillant and Sauvage, 1875, from Hawaii is amended. The morphology of both species conforms with the genus Pterobdella in possessing a spacious coelom, well-developed nephridial system, and 2 pairs of mycetomes. Originally described as Aestabdella abditovesiculata, P. occidentalis (present along the U.S. Pacific Coast), can be distinguished from most congeners by its metameric pigmentation pattern and diffuse pigmentation on the caudal sucker. Based on mitochondrial gene sequences, including cytochrome c oxidase subunit I (COI) and NADH dehydrogenase subunit I (ND1), P. occidentalis forms a distinct polyphyletic clade with Pterobdella leiostomi from the western Atlantic. Based on COI, ND1, and the 18S rRNA genes, other leech species most closely related to P. occidentalis include Pterobdella arugamensis from Iran, Malaysia, and possibly Borneo, which likely represent distinct species, and Pterobdella abditovesiculata from Hawaii, one of only a few endemic fish parasites in Hawaii. Like P. abditovesiculata, P. arugamensis, and Petrobdella amara, P. occidentalis is often found in estuarine environments, frequently infecting hosts adapted to a wide range of salinity, temperature, and oxygen. The physiological plasticity of P. occidentalis and the longjaw mudsucker host, and the ease of raising P. occidentalis in the lab, make it an excellent candidate for the study of leech physiology, behavior, and possible bacterial symbionts.

Division of developmental phases of freshwater leech Whitmania pigra and key genes related to neurogenesis revealed by whole genome and transcriptome analysis.

The freshwater leech Whitmania pigra (W. pigra) Whitman (Annelida phylum) is a model organism for neurodevelopmental studies. However, molecular biology research on its embryonic development is still scarce. Here, we described a series of developmental stages of the W. pigra embryos and defined five broad stages of embryogenesis: cleavage stages, blastocyst stage, gastrula stage, organogenesis and refinement, juvenile. We obtained a total of 239.64 Gb transcriptome data of eight representative developmental phases of embryos (from blastocyst stage to maturity), which was then assembled into 21,482 unigenes according to our reference genome sequenced by single-molecule real-time (SMRT) long-read sequencing. We found 3114 genes differentially expressed during the eight phases with phase-specific expression pattern. Using a comprehensive transcriptome dataset, we demonstrated that 57, 49 and 77 DEGs were respectively related to morphogenesis, signal pathways and neurogenesis. 49 DEGs related to signal pathways included 30 wnt genes, 14 notch genes, and 5 hedgehog genes. In particular, we found a cluster consisting of 7 genes related to signal pathways as well as synapses, which were essential for regulating embryonic development. Eight genes cooperatively participated in regulating neurogenesis. Our results reveal the whole picture of W. pigra development mechanism from the perspective of transcriptome and provide new clues for organogenesis and neurodevelopmental studies of Annelida species.

Cloning, characterization, and heterologous expression of a candidate Hirudin gene from the salivary gland transcriptome of Hirudo nipponia.

Hirudin is a pharmacologically active substance in leeches with potent blood anticoagulation properties. Although recombinant hirudin production isolated from Hirudo medicinalis Linnaeus and Hirudinaria manillensis Lesson is known, to our knowledge, this study is the first to report recombinant hirudin expression and production from Hirudo nipponia Whitman. Thus, the present study aimed to clone and characterize the full-length cDNA of a candidate hirudin gene (c16237_g1), which is localized on the salivary gland transcriptome of H. nipponia, and further evaluate its recombinant production using a eukaryotic expression system. The 489-bp cDNA possessed several properties of the hirudin "core" motifs associated with binding to the thrombin catalytic pocket. A fusion expression vector (pPIC9K-hirudin) was constructed and successfully transformed into Pichia pastoris strain GS115 via electroporation. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis and western blot analysis confirmed hirudin expression. The recombinant protein was expressed with a yield of 6.68 mg/L culture. Mass spectrometry analysis further confirmed target protein expression. The concentration and antithrombin activity of purified hirudin were 1.67 mg/mL and 14,000 ATU/mL, respectively. These findings provide a basis for further elucidating the molecular anticoagulation mechanism of hirudin, and address China's growing market demand for engineered H. nipponia-derived hirudin and hirudin-based drugs.

The Complete Mitochondrial Genome of Torix tukubana (Annelida: Hirudinea: Glossiphoniidae).

Torix tukubana is a poorly understood proboscidate leech species, generally an ectoparasite on amphibian species. In this study, the complete mitochondrial genome (mitogenome) of T. tukubana was sequenced using next-generation sequencing (NGS), and the essential characteristics, gene arrangement, and phylogenetic relationship were analyzed. The results showed that the T. tukubana mitogenome was 14,814 bp in length, consisting of 13 protein-coding genes (PCGs), 22 tRNAs, 2 rRNAs, and 1 control region (CR). The mitogenome composition presented a strong A + T bias (73.6%). All tRNAs had the typical clover structure except the trnS1 (TCT), whose dihydrouridine (DHU) arm was short, having only one complementary base pair. Additionally, 8 gene order patterns were identified among 25 known Hirudinea species, and T. tukubana was identical to the Hirudinea ground pattern. A phylogenetic analysis based on 13 PCGs indicated that all the studied species clustered into three main clades. The relationships among Hirudinea species were basically consistent with their gene arrangement results, but different from their morphological taxonomy. T. tukubana was in the monophyletic group of Glossiphoniidae, a finding consistent with previous research. Our results provided the essential characteristics of the T. tukubana mitogenome. As the first complete mitogenome of Torix, it could offer valuable information for a systematic understanding of the Hirudinea species.

Phylogenetic relationships and species delimitation in Haemopis (Annelida: Hirudinea: Haemopidae).

The Holarctic leech genus Haemopis currently includes 11 species, all of which are macrophagous, as opposed to their more infamous bloodfeeding counterparts among hirudiniform leeches. In spite of their ecological importance as fish food and predators of freshwater invertebrates, there is a paucity of data regarding morphology and genetic variation that might guide future identification efforts for members of the genus. The lack of detailed descriptions of distinguishing morphological features, coupled with the absence of a robust phylogenetic hypothesis for the genus, have conspired to prevent meaningful inferences on the natural history of the group. In an attempt to remedy this, we present new genetic (using COI, 12S rDNA, 28S rDNA and 18S rDNA) data for the majority of the known species diversity within the genus in order to both infer a phylogenetic hypothesis and to introduce authoritative DNA barcodes for the newly collected species. The potential of these barcodes is increased through rigorous morphological investigations of the specimens, with comparisons to the original literature. Our resulting phylogenetic hypothesis is agnostic as to the geographic origin of the genus, with equal probability afforded to both a Nearctic and Palearctic origin. Beyond this, we show that there is a strong tendency towards a barcoding gap within the genus, but that a distinct gap is lacking due to the relatively high genetic variation found within H. marmorata. Taken together, our results shed light on species delimitation within, and evolutionary history of, this often-neglected group of leeches.

Cryptic taxonomic diversity and high-latitude melanism in the glossiphoniid leech assemblage from the Eurasian Arctic.

The family Glossiphoniidae is a diverse and widespread clade of freshwater leeches, playing a significant role in functioning of aquatic ecosystems. The taxonomy and biogeography of leeches from temperate, subtropical, and tropical regions attracted much attention of zoologists, while their taxonomic richness and distribution in the Arctic are poorly understood. Here, we present an overview of the Eurasian Arctic Glossiphoniidae based on the most comprehensive occurrence and DNA sequence datasets sampled to date. This fauna contains 14 species, belonging to five genera and three subfamilies. One genus and five species are new to science and described here. The world's northernmost occurrences of glossiphoniids are situated on the Taymyr Peninsula at 72° N, although further records at higher latitudes are expected. Most Arctic leeches are characterized by broad ranges crossing several climatic zones (e.g., Glossiphonia balcanica and G. nebulosa), although the distribution of two new species may be confined to the high-latitude areas. The Taymyr Peninsula with the nearby Putorana Plateau represents the most species-rich area (totally 9 species), while the European Arctic, Iceland, Kolyma Highland, and Chukotka Peninsula house depleted faunas (2-4 species per subregion). Finally, we show that the high-latitude melanism is a common phenomenon in glossiphoniid leeches.

Population Genetic Structure of Marine Leech, Pterobdella arugamensis in Indo-West Pacific Region.

Grouper aquaculture is rapidly expanding in both tropical and subtropical regions. The presence of marine leeches (Pterobdella arugamensis; previously named Zeylanicobdella arugamensis) infesting cultured groupers, however, can have a fatal effect on grouper aquaculture production and cause significant economic loss. Understanding the marine leech's population structure is therefore important to determine its possible distributional origin and distributional mechanisms, which will help monitor and mitigate the infestation. In this study, a total of 84 marine leeches collected from cultured hybrid groupers Epinephelus spp. in Brunei Darussalam, Malaysia and Indonesia were identified as P. arugamensis, based on morphological and mitochondrial cytochrome c oxidase subunit I gene sequence analyses. These leech samples, together with additional sequences from the GenBank database, were grouped into four genetically distinct haplogroups: (1) Asia Pacific, (2) Borneo, (3) Surabaya and (4) Iran. The four populations were found to be highly diverged from each other. The results also suggested that the samples from the Asia Pacific population could be dispersed and transported from Indonesia.

Life without blood: Molecular and functional analysis of hirudins and hirudin-like factors of the Asian non-hematophagous leech Whitmania pigra.

BACKGROUND: Several leech species of the genera Hirudo, Hirudinaria, and Whitmania are widely used in traditional Chinese medicine (TCM) for the oral treatment of disorders associated with blood stasis. Among them, the non-hematophagous leech Whitmania pigra expresses a variety of components that have the potential to act on the vertebrate blood coagulation system. OBJECTIVE: Whether the thrombin inhibitor hirudin, probably the most prominent leech-derived anticoagulant, is actually present in Whitmania pigra, is still a matter of debate. To answer that open question was the aim of the study. METHODS: We identified several putative hirudin-encoding sequences in transcriptome data of Whitmania pigra. Upon gene synthesis and molecular cloning the respective recombinant proteins were expressed in Escherichia coli, purified, processed, and eventually functionally characterized for thrombin-inhibitory potencies in coagulation assays. RESULTS: We were successful in the identification and functional characterization of several putative hirudins in Whitmania pigra. Some, but not all, of these factors are indeed thrombin inhibitors. Whitmania pigra hence expresses both hirudins (factors that inhibit thrombin) and hirudin-like factors (that do not or only very weakly inhibit thrombin). Furthermore, we revealed the exon/intron structures of the corresponding genes. Coding sequences of some putative hirudins of Whitmania pigra were present also in transcriptome datasets of Hirudo nipponia, a hematophagous leech that is likewise used in TCM. CONCLUSIONS: Based on both structural and functional data we provide very strong evidence for the expression of hirudins in Whitmania pigra. This is the first description of hirudins in a non-hematophagous leech.

Glossiphoniid leeches as a touchstone for studies of development in clitellate annelids.

My goals in this chapter are to share my enthusiasm for studying the biology of leeches, to place this work in context by presenting my rationale for studying non-traditional biological models in general, and to sample just three of the questions that intrigue me in leech biology, namely segmentation, genome evolution and neuronal fate specification. I first became excited about the idea of using leeches as a subject of investigation as an undergraduate in 1970 and have been engaged in this work since I arrived at Berkeley as a postdoc in 1976, intending to study leech neurobiology. Both my research interests and the rationale for the work have expanded greatly since then. What follows is a fragmentary personal and historical account-the interested reader may find more comprehensive treatments elsewhere (Kuo et al., 2020; Shankland & Savage, 1997; Shain, 2009; Weisblat & Huang, 2001; Weisblat & Kuo, 2009, 2014; Weisblat & Winchell, 2020).

Head transcriptome profiling of glossiphoniid leech (Helobdella austinensis) reveals clues about proboscis development.

Cephalization refers to the evolutionary trend towards the concentration of neural tissues, sensory organs, mouth and associated structures at the front end of bilaterian animals. Comprehensive studies on gene expression related to the anterior formation in invertebrate models are currently lacking. In this study, we performed de novo transcriptional profiling on a proboscis-bearing leech (Helobdella austinensis) to identify differentially expressed genes (DEGs) in the anterior versus other parts of the body, in particular to find clues as to the development of the proboscis. Between the head and the body, 132 head-specific DEGs were identified, of which we chose 11 to investigate their developmental function during embryogenesis. Analysis of the spatial expression of these genes using in situ hybridization showed that they were characteristically expressed in the anterior region of the developing embryo, including the proboscis. Our results provide information on the genes related to head formation and insights into the function of proboscis-related genes during organogenesis with the potential roles of genes not yet characterized.